Review





Similar Products

94
Bioss anti dlat
Anti Dlat, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dlat/PDCE2+Polyclonal+Antibody/pmc13131405-74-0-4
Average 94 stars, based on 1 article reviews
anti dlat - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
Vector Biolabs pcmv flag dlat p71850
Pcmv Flag Dlat P71850, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dlat/AAV-h-DLAT-shRNA/pm42009144-62-20-17
Average 94 stars, based on 1 article reviews
pcmv flag dlat p71850 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

86
Servicebio Inc rabbit anti dlat
Rabbit Anti Dlat, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dlat/anti+dlat+rabbit/pm42260670-100-24-29
Average 86 stars, based on 1 article reviews
rabbit anti dlat - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech ctccttaatgtcacgcacgat sangon biotech n a primer dlat forward
Ctccttaatgtcacgcacgat Sangon Biotech N A Primer Dlat Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dlat/primers/pm42054210-662-108-109
Average 86 stars, based on 1 article reviews
ctccttaatgtcacgcacgat sangon biotech n a primer dlat forward - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech cggaactccacgagtgacc sangon biotech n a primer dlat reverse
Cggaactccacgagtgacc Sangon Biotech N A Primer Dlat Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dlat/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-115-116
Average 86 stars, based on 1 article reviews
cggaactccacgagtgacc sangon biotech n a primer dlat reverse - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

94
Vector Biolabs human dlat shrna silencing aav
Human Dlat Shrna Silencing Aav, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dlat/AAV-h-DLAT-shRNA/pm42009144-62-9-17
Average 94 stars, based on 1 article reviews
human dlat shrna silencing aav - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

96
Proteintech antibody dlat
Antibody Dlat, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dlat/DLAT+Antibody/pm41928317-89-8-13
Average 96 stars, based on 1 article reviews
antibody dlat - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Proteintech anti dlat antibody
Anti Dlat Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dlat/DLAT+Antibody/pm41928317-86-9-14
Average 96 stars, based on 1 article reviews
anti dlat antibody - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Proteintech skim milk
Skim Milk, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dlat/DLAT+Antibody/pmc12906090-131-7-21
Average 96 stars, based on 1 article reviews
skim milk - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

Image Search Results