|
Bioss
anti dlat Anti Dlat, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dlat/PDCE2+Polyclonal+Antibody/pmc13131405-74-0-4 Average 94 stars, based on 1 article reviews
anti dlat - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Vector Biolabs
pcmv flag dlat p71850 Pcmv Flag Dlat P71850, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dlat/AAV-h-DLAT-shRNA/pm42009144-62-20-17 Average 94 stars, based on 1 article reviews
pcmv flag dlat p71850 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Servicebio Inc
rabbit anti dlat Rabbit Anti Dlat, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dlat/anti+dlat+rabbit/pm42260670-100-24-29 Average 86 stars, based on 1 article reviews
rabbit anti dlat - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
ctccttaatgtcacgcacgat sangon biotech n a primer dlat forward Ctccttaatgtcacgcacgat Sangon Biotech N A Primer Dlat Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dlat/primers/pm42054210-662-108-109 Average 86 stars, based on 1 article reviews
ctccttaatgtcacgcacgat sangon biotech n a primer dlat forward - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
cggaactccacgagtgacc sangon biotech n a primer dlat reverse Cggaactccacgagtgacc Sangon Biotech N A Primer Dlat Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dlat/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-115-116 Average 86 stars, based on 1 article reviews
cggaactccacgagtgacc sangon biotech n a primer dlat reverse - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Vector Biolabs
human dlat shrna silencing aav Human Dlat Shrna Silencing Aav, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dlat/AAV-h-DLAT-shRNA/pm42009144-62-9-17 Average 94 stars, based on 1 article reviews
human dlat shrna silencing aav - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Proteintech
antibody dlat Antibody Dlat, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dlat/DLAT+Antibody/pm41928317-89-8-13 Average 96 stars, based on 1 article reviews
antibody dlat - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Proteintech
anti dlat antibody Anti Dlat Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dlat/DLAT+Antibody/pm41928317-86-9-14 Average 96 stars, based on 1 article reviews
anti dlat antibody - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Proteintech
skim milk Skim Milk, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dlat/DLAT+Antibody/pmc12906090-131-7-21 Average 96 stars, based on 1 article reviews
skim milk - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |